answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
2 years ago
8

The human genome contains about 3 billion base pairs. During the first cell division after fertilization of a human embryo, S ph

ase is approximately three hours long. Assuming an average DNA polymerase rate of 50 nucleotides/second over the entire S phase, what is the minimum number of origins of replication you would expect to find in the human genome?
Biology
2 answers:
Nataly [62]2 years ago
7 0

Answer:

5556

Explanation:

If a DNA polymerase synthesizes in average 50 nucleotides/second, that means that in three hours (10800 seconds) it synthesizes about 540000 nucleotides.

However, if the human genome is composed of 3000000000 (3 billion) base pairs (nucleotids), the minimum number of DNA polymerases (working in the same number of origins of replication) to finish the duplication of all the genome in three hours is 5555,5. (3000000000/540000). As we know there is no half polymerase, so we round to 5556.

5556 molecules of DNA polymerases acting on 5556  origins of replication are needed.

Volgvan2 years ago
6 0

Answer:

5555 replication origins.

Explanation:

The human genome contains about 3000 million base pairs, all of them are copied during the S phase by the DNA polymerase. In this case, you are supposing that the DNA polymerase can copy 50 nucleotides/second, so all of this work is done in 10800 seconds, if you multiply 50 nuc/sec by 10800 sec, we obtain that a single replication origin can copy 540000 nucleotides in three hours. Now if you divide 3000 millions by 540000 you will obtain the aproximate number of replication origins in human cells, that is 5555.

You might be interested in
2.) From where do lion cubs get their chromosomes? How does this happen to produce the pattern that you see?​
Vlad [161]

Answer:

This question is incomplete

Explanation:

This question is incomplete.

However, lions have 38 chromosomes (19 pairs) and <u>there cubs get their chromosomes from there parents</u>; with each parent donating 19 each. They also have a pair of chromosomes known as sex chromosomes (X and Y). The female always donates the X chromosome and the male donates either a X (which leads to a female cub) or a Y (which leads to a male cub), just like in many mammals.

NOTE: Chromosomes are threadlike structures in the nucleus of a cell that carry/stores genetic materials/genes.

7 0
2 years ago
Why is it that evolution genetics and biochemistry are considered as unifying themes in biology
snow_lady [41]
Without evolution biology has thousands isolated and related facts
8 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Autotrophs that utilize light as their energy source are
k0ka [10]

The correct answer is - phototrophs.

Some of the autotrophs are able to convert the electromagnetic energy from the sunlight into chemical energy in the form of reduced carbon (C). The autotrophs that are able to perform this are called phototrophs. The green plants and the algae are the most prominent members of the phototroph autotrophs.

In essence, the autotrophs are producers, meaning that they are able to produce their own food. The phototrophs are the part of the autotrophs that are able to use the sunlight to produce small amounts of ATP as well as the energy carrier NADHP. By producing the ATP and the NADHP the phototrophs manage to produce glucose, or rather sugars, which are actually their food.

8 0
2 years ago
okay consider a cross of beetles with exoskeleton allies B and b and leg size alleles N and n. the male parent is heterozygous i
Yuki888 [10]
The male parents traits would be Bb and Nn
The female parents traits would be bb and nn
6 0
2 years ago
Read 2 more answers
Other questions:
  • The path moisture takes from the ocean to the runoff that forms a river
    8·2 answers
  • Suppose you are designing an experiment to test the effects of nicotine on the heart rate of rats. what are the disadvantages of
    12·1 answer
  • Which is an immune response? The iris of the eye narrows when the eyes are exposed to bright light. Langerhans cells transport h
    7·2 answers
  • A normal bacterial cell carries on the chemical reaction A-----------&gt;B. A certain mutant bacterial cell cannot produce subst
    5·2 answers
  • Which has not been a major source of CFCs?
    8·2 answers
  • In the Amazon rain forest, ______________ is discerning what will make an effective herbal treatment; in the United States, ____
    12·2 answers
  • Which statement describe a pattern shown in the data?
    8·2 answers
  • Q2.25. Assume that early in the summer, the only prey available are stoneflies and caddisflies. If the search time for its prefe
    14·1 answer
  • Why are all bacteria classified as prokaryotes?
    8·2 answers
  • A strand of DNA contains the bases adenine, cytosine, cytosine, and guanine, in that order. Which would be the order
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!