Answer:
This question is incomplete
Explanation:
This question is incomplete.
However, lions have 38 chromosomes (19 pairs) and <u>there cubs get their chromosomes from there parents</u>; with each parent donating 19 each. They also have a pair of chromosomes known as sex chromosomes (X and Y). The female always donates the X chromosome and the male donates either a X (which leads to a female cub) or a Y (which leads to a male cub), just like in many mammals.
NOTE: Chromosomes are threadlike structures in the nucleus of a cell that carry/stores genetic materials/genes.
Without evolution biology has thousands isolated and related facts
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
The correct answer is - phototrophs.
Some of the autotrophs are able to convert the electromagnetic energy from the sunlight into chemical energy in the form of reduced carbon (C). The autotrophs that are able to perform this are called phototrophs. The green plants and the algae are the most prominent members of the phototroph autotrophs.
In essence, the autotrophs are producers, meaning that they are able to produce their own food. The phototrophs are the part of the autotrophs that are able to use the sunlight to produce small amounts of ATP as well as the energy carrier NADHP. By producing the ATP and the NADHP the phototrophs manage to produce glucose, or rather sugars, which are actually their food.
The male parents traits would be Bb and Nn
The female parents traits would be bb and nn