Answer:
look in textbook - concept 29.6
Explanation:
Drought stress can also cause stomata to close. A hormone called abscisic acid (ABA) is produced in roots and leaves in response to water deficiency and signals guard cells to close stomata. This response reduces wilting but also restricts CO2 absorption, thereby slowing photosynthesis. ABA also directly inhibits photosynthesis. Water availability is so tied to plant productivity not because water is needed as a substrate in photosynthesis but because freely available water allows plants to keep stomata open and take up more CO2.
abscisic acid (ABA): A plant hormone that slows growth, often antagonizing the actions of growth hormones. Two of its many effects are to promote seed dormancy and facilitate drought tolerance.
A weight gain of 11-18 pounds doubles<span> a person's </span>risk<span> of. Type 2 Diabetes.</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Make a paraffin block with that wing present inside. Now make fine slices of that block. Take one fine & even slice on a slide & then stain it.
Hope this helps you!
The growth of the population is described below.
<h3><u>Explanation</u>:</h3>
The population growth of the region is varying according to many factors like,
A. Members of the reproductive age group.
B. Availability of nutrition.
C. Mortality rate of the population.
Here the members of the reproductive age group are few. The population being small in a large area there is a high availability of nutrients.
So the growth rate of the population will be very high. This is called the log phase of the growth.
Then comes the lag phase of growth where the population is considerably big with a fight for food and shelter. The survival of the fittest is seen and the population still grows but slowly. This is the lag phase.
But with time, the population growth is stopped because the ecosystem has a particular carrying capacity which is the maximum number of population that the ecosystem can support. So beyond this, the population won't increase, and thereby the natality rate and the mortality rate becomes equal.
